Cabergoline: a review of its use in the inhibition of lactation for women living with HIV.

In developed countries, breastfeeding is not recommended for women living with human immunodeficiency virus (WLWH). However, lactation symptoms can be distressing for women who choose not to breastfeed.

There is currently no universal guideline on the most appropriate options for prevention or reduction of lactation symptoms amongst WLWH. This review describes the evidence base for using cabergoline, a dopaminergic agonist, for the post-partum inhibition of lactation for WLWH.

ADAMTS18 antibody

70R-4602 50 ug
EUR 467.00
Description: Rabbit polyclonal ADAMTS18 antibody raised against the N terminal of ADAMTS18

ADAMTS18 antibody

70R-33996 100 ug
EUR 327.00
Description: Rabbit polyclonal ADAMTS18 antibody

ADAMTS18 Antibody

ABD3740 100 ug
EUR 438.00

ADAMTS18 Antibody

34387-100ul 100ul
EUR 252.00

ADAMTS18 Antibody

34387-50ul 50ul
EUR 187.00

ADAMTS18 siRNA

20-abx906758
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ADAMTS18 siRNA

20-abx906759
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ADAMTS18 Antibody

1-CSB-PA493628
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against ADAMTS18. Recognizes ADAMTS18 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC-p:1:100-1:300.ELISA:1/10000

ADAMTS18 Antibody

1-CSB-PA978160
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ADAMTS18. Recognizes ADAMTS18 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000

ADAMTS18 Antibody

1-CSB-PA903364
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ADAMTS18. Recognizes ADAMTS18 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

anti-ADAMTS18

YF-PA22638 50 ug
EUR 363.00
Description: Mouse polyclonal to ADAMTS18

ADAMTS18 Antibody

DF3740 200ul
EUR 304.00
Description: ADAMTS18 Antibody detects endogenous levels of total ADAMTS18.

ADAMTS18 Conjugated Antibody

C34387 100ul
EUR 397.00

ADAMTS18 cloning plasmid

CSB-CL851556HU-10ug 10ug
EUR 1294.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3666
  • Sequence: atggagtgcgccctcctgctcgcgtgtgccttcccggctgcgggttcgggcccgccgaggggcctggcgggactggggcgcgtggccaaggcgctccagctgtgctgcctctgctgtgcgtcggtcgccgcggccttagccagtgacagcagcagcggcgccagcggattaaatg
  • Show more
Description: A cloning plasmid for the ADAMTS18 gene.

ADAMTS18 Blocking Peptide

33R-3140 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ADAMTS18 antibody, catalog no. 70R-4602

ADAMTS18 Blocking Peptide

20-abx161008
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

ADAMTS18 Polyclonal Antibody

E-AB-12693-120uL 120uL
EUR 257.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3
  • Purified by: Affinity purification
  • Background: This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs)
  • Show more
Description: Rabbit antibody against Human,Mouse ADAMTS18 for WB,ELISA applications.

ADAMTS18 Polyclonal Antibody

E-AB-12693-20uL 20uL
EUR 130.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3
  • Purified by: Affinity purification
  • Background: This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs)
  • Show more
Description: Rabbit antibody against Human,Mouse ADAMTS18 for WB,ELISA applications.

ADAMTS18 Polyclonal Antibody

E-AB-12693-60uL 60uL
EUR 175.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3
  • Purified by: Affinity purification
  • Background: This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs)
  • Show more
Description: Rabbit antibody against Human,Mouse ADAMTS18 for WB,ELISA applications.

ADAMTS18 Polyclonal Antibody

E-AB-34236-120uL 120uL
EUR 257.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide, 0.5% BSA and 50% glycerol, pH7.4
  • Purified by: Affinity purification
  • Background: This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombosp
  • Show more
Description: Rabbit antibody against Human,Mouse ADAMTS18 for WB,IHC-p,ELISA applications.

ADAMTS18 Polyclonal Antibody

E-AB-34236-20uL 20uL
EUR 130.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide, 0.5% BSA and 50% glycerol, pH7.4
  • Purified by: Affinity purification
  • Background: This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombosp
  • Show more
Description: Rabbit antibody against Human,Mouse ADAMTS18 for WB,IHC-p,ELISA applications.

ADAMTS18 Polyclonal Antibody

E-AB-34236-60uL 60uL
EUR 175.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide, 0.5% BSA and 50% glycerol, pH7.4
  • Purified by: Affinity purification
  • Background: This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombosp
  • Show more
Description: Rabbit antibody against Human,Mouse ADAMTS18 for WB,IHC-p,ELISA applications.

ADAMTS18 Blocking Peptide

DF3740-BP 1mg
EUR 195.00

Mouse ADAMTS18 shRNA Plasmid

20-abx980584
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human ADAMTS18 shRNA Plasmid

20-abx966125
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

ADAMTS18 ELISA KIT|Human

EF006359 96 Tests
EUR 689.00

Human ADAMTS18 ELISA Kit

ELA-E4831h 96 Tests
EUR 824.00

Human ADAMTS18 ELISA KIT

ELI-11463h 96 Tests
EUR 824.00

Mouse Adamts18 ELISA KIT

ELI-33373m 96 Tests
EUR 865.00

ADAMTS18 ORF Vector (Human) (pORF)

ORF000179 1.0 ug DNA
EUR 95.00

Adamts18 ORF Vector (Mouse) (pORF)

ORF038104 1.0 ug DNA
EUR 506.00

Adamts18 ORF Vector (Rat) (pORF)

ORF063066 1.0 ug DNA
EUR 506.00

Adamts18 sgRNA CRISPR Lentivector set (Mouse)

K3868201 3 x 1.0 ug
EUR 339.00

ADAMTS18 sgRNA CRISPR Lentivector set (Human)

K0045201 3 x 1.0 ug
EUR 339.00

Adamts18 sgRNA CRISPR Lentivector set (Rat)

K6191801 3 x 1.0 ug
EUR 339.00

Adamts18 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3868202 1.0 ug DNA
EUR 154.00

Adamts18 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3868203 1.0 ug DNA
EUR 154.00

Adamts18 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3868204 1.0 ug DNA
EUR 154.00

ADAMTS18 sgRNA CRISPR Lentivector (Human) (Target 1)

K0045202 1.0 ug DNA
EUR 154.00

ADAMTS18 sgRNA CRISPR Lentivector (Human) (Target 2)

K0045203 1.0 ug DNA
EUR 154.00

ADAMTS18 sgRNA CRISPR Lentivector (Human) (Target 3)

K0045204 1.0 ug DNA
EUR 154.00

ADAMTS18 Protein Vector (Rat) (pPB-C-His)

PV252262 500 ng
EUR 1166.00

ADAMTS18 Protein Vector (Rat) (pPB-N-His)

PV252263 500 ng
EUR 1166.00

ADAMTS18 Protein Vector (Rat) (pPM-C-HA)

PV252264 500 ng
EUR 1166.00

ADAMTS18 Protein Vector (Rat) (pPM-C-His)

PV252265 500 ng
EUR 1166.00

Adamts18 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6191802 1.0 ug DNA
EUR 154.00

Adamts18 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6191803 1.0 ug DNA
EUR 154.00

Adamts18 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6191804 1.0 ug DNA
EUR 154.00

ADAMTS18 Protein Vector (Mouse) (pPB-C-His)

PV152414 500 ng
EUR 1065.00

ADAMTS18 Protein Vector (Mouse) (pPB-N-His)

PV152415 500 ng
EUR 1065.00

ADAMTS18 Protein Vector (Mouse) (pPM-C-HA)

PV152416 500 ng
EUR 1065.00

ADAMTS18 Protein Vector (Mouse) (pPM-C-His)

PV152417 500 ng
EUR 1065.00

ADAMTS18 Protein Vector (Human) (pPB-C-His)

PV000713 500 ng
EUR 329.00

ADAMTS18 Protein Vector (Human) (pPB-N-His)

PV000714 500 ng
EUR 329.00

ADAMTS18 Protein Vector (Human) (pPM-C-HA)

PV000715 500 ng
EUR 329.00

ADAMTS18 Protein Vector (Human) (pPM-C-His)

PV000716 500 ng
EUR 329.00

ADAMTS18 3'UTR Luciferase Stable Cell Line

TU000332 1.0 ml
EUR 4617.00

Adamts18 3'UTR GFP Stable Cell Line

TU151393 1.0 ml Ask for price

Adamts18 3'UTR Luciferase Stable Cell Line

TU200277 1.0 ml Ask for price

ADAMTS18 Protein Vector (Human) (pPB-His-MBP)

PV319866 500 ng
EUR 329.00

ADAMTS18 Protein Vector (Human) (pPB-His-GST)

PV319867 500 ng
EUR 329.00

ADAMTS18 3'UTR GFP Stable Cell Line

TU050332 1.0 ml
EUR 4617.00

Adamts18 3'UTR Luciferase Stable Cell Line

TU101393 1.0 ml Ask for price

Adamts18 3'UTR GFP Stable Cell Line

TU250277 1.0 ml Ask for price

ADAMTS18 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV650521 1.0 ug DNA
EUR 1355.00

ADAMTS18 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV650525 1.0 ug DNA
EUR 1355.00

ADAMTS18 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV650526 1.0 ug DNA
EUR 1355.00

Adamts18 ELISA Kit| Mouse A disintegrin and metalloproteinase w

EF014135 96 Tests
EUR 689.00

ADAMTS18 Protein Vector (Human) (pPM-N-D-C-HA)

PV319868 500 ng
EUR 329.00

ADAMTS18 Protein Vector (Human) (pPM-N-D-C-His)

PV319869 500 ng
EUR 329.00

ADAM Metallopeptidase With Thrombospondin Type 1 Motif 18 (ADAMTS18) Antibody

abx038097-100ug 100 ug
EUR 391.00
  • Shipped within 5-10 working days.

ADAM Metallopeptidase With Thrombospondin Type 1 Motif 18 (ADAMTS18) Antibody

20-abx121008
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Adamts18 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K3868205 3 x 1.0 ug
EUR 376.00

ADAM Metallopeptidase With Thrombospondin Type 1 Motif 18 (ADAMTS18) Antibody

20-abx326245
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

ADAM Metallopeptidase With Thrombospondin Type 1 Motif 18 (ADAMTS18) Antibody

20-abx212036
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

ADAM Metallopeptidase With Thrombospondin Type 1 Motif 18 (ADAMTS18) Antibody

20-abx212832
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

ADAM Metallopeptidase With Thrombospondin Type 1 Motif 18 (ADAMTS18) Antibody

20-abx014155
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Human A disintegrin and metalloproteinase with thrombospondin motifs 18 (ADAMTS18)

1-CSB-EP851556HU
  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 15.5 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18),partial expressed in E.coli

ADAM Metallopeptidase With Thrombospondin Type 1 Motif 18 (ADAMTS18) Antibody

abx331727-100ul 100 ul
EUR 425.00
  • Shipped within 5-10 working days.

ADAMTS18 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0045205 3 x 1.0 ug
EUR 376.00

Adamts18 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6191805 3 x 1.0 ug
EUR 376.00

Adamts18 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K3868206 1.0 ug DNA
EUR 167.00

Adamts18 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K3868207 1.0 ug DNA
EUR 167.00

Adamts18 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K3868208 1.0 ug DNA
EUR 167.00

Human ADAMTS18(A Disintegrin And Metalloproteinase With Thrombospondin 18) ELISA Kit

E-EL-H5602-192 192 tests
EUR 895.00
  • No significant cross-reactivity with analogues from other species was determined. Please, note that the data on cross-reactivity is limited. Other samples, aside from the tested ones, may be suitable to be used with this kit.
Description: This ELISA kit uses the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human ADAMTS18. Standards or samples are added to the micro ELISA plate wells and combined with the specific antibody. Then a biotinylated detection antibody specific for Human ADAMTS18 and Avidin-Horseradish Peroxidase (HRP) conjugate are added successively to each micro plate well and incubated. Free components are washed away. The substrate solution is added to each well. Only those wells that contain Human ADAMTS18, biotinylated detection antibody and Avidin-HRP conjugate will appear blue in color. The enzyme-substrate reaction is terminated by the addition of stop solution and the color turns yellow. The optical density (OD) is measured spectrophotometrically at a wavelength of 450 nm ± 2 nm. The OD value is proportional to the concentration of Human ADAMTS18. You can calculate the concentration of Human ADAMTS18 in the samples by comparing the OD of the samples to the standard curve.

Human ADAMTS18(A Disintegrin And Metalloproteinase With Thrombospondin 18) ELISA Kit

E-EL-H5602-96 96 tests
EUR 530.00
  • No significant cross-reactivity with analogues from other species was determined. Please, note that the data on cross-reactivity is limited. Other samples, aside from the tested ones, may be suitable to be used with this kit.
Description: This ELISA kit uses the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human ADAMTS18. Standards or samples are added to the micro ELISA plate wells and combined with the specific antibody. Then a biotinylated detection antibody specific for Human ADAMTS18 and Avidin-Horseradish Peroxidase (HRP) conjugate are added successively to each micro plate well and incubated. Free components are washed away. The substrate solution is added to each well. Only those wells that contain Human ADAMTS18, biotinylated detection antibody and Avidin-HRP conjugate will appear blue in color. The enzyme-substrate reaction is terminated by the addition of stop solution and the color turns yellow. The optical density (OD) is measured spectrophotometrically at a wavelength of 450 nm ± 2 nm. The OD value is proportional to the concentration of Human ADAMTS18. You can calculate the concentration of Human ADAMTS18 in the samples by comparing the OD of the samples to the standard curve.

ADAMTS18 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K0045206 1.0 ug DNA
EUR 167.00

ADAMTS18 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K0045207 1.0 ug DNA
EUR 167.00

ADAMTS18 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K0045208 1.0 ug DNA
EUR 167.00

ADAMTS18 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV650522 1.0 ug DNA
EUR 1355.00

ADAMTS18 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV650523 1.0 ug DNA
EUR 1413.00

ADAMTS18 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV650524 1.0 ug DNA
EUR 1413.00

Adamts18 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K6191806 1.0 ug DNA
EUR 167.00

Adamts18 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K6191807 1.0 ug DNA
EUR 167.00

Adamts18 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K6191808 1.0 ug DNA
EUR 167.00

Monkey A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) ELISA kit

E09A0935-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) ELISA kit

E09A0935-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) ELISA kit

E09A0935-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) ELISA kit

E08A0935-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) ELISA kit

E08A0935-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) ELISA kit

E08A0935-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human ADAM Metallopeptidase With Thrombospondin Type 1 Motif 18 (ADAMTS18) ELISA Kit

abx520409-96tests 96 tests
EUR 754.00
  • Shipped within 5-12 working days.

Mouse ADAM Metallopeptidase With Thrombospondin Type 1 Motif 18 (ADAMTS18) ELISA Kit

abx520410-96tests 96 tests
EUR 668.00
  • Shipped within 5-12 working days.

Human ADAM Metallopeptidase With Thrombospondin Type 1 Motif 18 (ADAMTS18) ELISA Kit

abx251648-96tests 96 tests
EUR 754.00
  • Shipped within 5-12 working days.

Human A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) ELISA kit

CSB-EL001306HU-24T 1 plate of 24 wells
EUR 165.00
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human A disintegrin and metalloproteinase with thrombospondin motifs 18 (ADAMTS18) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) ELISA kit

1-CSB-EL001306HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Rabbit A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) ELISA kit

E04A0935-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) ELISA kit

E04A0935-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) ELISA kit

E04A0935-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Human ADAMTS18 (A Disintegrin And Metalloproteinase With Thrombospondin 18)

E-EL-H5602 1 plate of 96 wells
EUR 534.00
  • Gentaur's ADAMTS18 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human ADAMTS18. Standards or samples are added to the micro ELISA plate wells and combined
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human ADAMTS18 (A Disintegrin And Metalloproteinase With Thrombospondin 18) in samples from Serum, Plasma, Cell supernatant

Human A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) ELISA kit

E01A0935-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) ELISA kit

E01A0935-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) ELISA kit

E01A0935-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) ELISA kit

E06A0935-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) ELISA kit

E06A0935-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) ELISA kit

E06A0935-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) ELISA kit

E07A0935-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) ELISA kit

E07A0935-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) ELISA kit

E07A0935-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) ELISA kit

E03A0935-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) ELISA kit

E03A0935-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) ELISA kit

E03A0935-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) ELISA kit

E02A0935-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) ELISA kit

E02A0935-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) ELISA kit

E02A0935-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Adamts18/ A disintegrin and metalloproteinase with thrombospondin motifs 18 ELISA Kit

E0034Mo 1 Kit
EUR 632.00

Human ADAMTS18/ A disintegrin and metalloproteinase with thrombospondin motifs 18 ELISA Kit

E0052Hu 1 Kit
EUR 605.00

Human ADAMTS18(A disintegrin and metalloproteinase with thrombospondin motifs 18) ELISA Kit

EH2297 96T
EUR 567.60
  • Detection range: 78-5000 pg/ml
  • Uniprot ID: Q8TE60
  • Alias: ADAMTS18/ADAM-TS 18/ADAM-TS18/ADAMTS-18/ADAMTS18/ADAMTS21/3.4.24.-
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.9pg/ml

Guinea pig A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) ELISA kit

E05A0935-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) ELISA kit

E05A0935-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) ELISA kit

E05A0935-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

A scoping review of post-partum pharmaceutical lactation inhibition specific for WLWH was conducted using searches in PubMed, Medline Ovid, EBM Reviews Ovid, Embase, Web of Science and Scopus until 2019.

A narrative review of cabergoline pharmacologic properties, therapeutic efficacy, tolerability data and drug interaction data relevant to lactation inhibition was then conducted. Among 1366 articles, the scoping review identified 13 relevant publications.

Eight guidelines providing guidance regarding lactation inhibition for WLWH and two surveys of medical practice on this topic in UK have been published.