Cabergoline: a review of its use in the inhibition of lactation for women living with HIV.

In developed countries, breastfeeding is not recommended for women living with human immunodeficiency virus (WLWH). However, lactation symptoms can be distressing for women who choose not to breastfeed.

There is currently no universal guideline on the most appropriate options for prevention or reduction of lactation symptoms amongst WLWH. This review describes the evidence base for using cabergoline, a dopaminergic agonist, for the post-partum inhibition of lactation for WLWH.

ADAMTS18 Antibody
1-CSB-PA978160	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ADAMTS18. Recognizes ADAMTS18 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000

ADAMTS18 Antibody
CSB-PA999160-	Cusabio		EUR 335
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against ADAMTS18. Recognizes ADAMTS18 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

ADAMTS18 Antibody
CSB-PA999160-100ul	Cusabio	100ul	EUR 316
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against ADAMTS18. Recognizes ADAMTS18 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

ADAMTS18 Antibody
1-CSB-PA903364	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ADAMTS18. Recognizes ADAMTS18 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

ADAMTS18 Antibody
DF3740	Affbiotech	200ul	EUR 304
Description: ADAMTS18 Antibody detects endogenous levels of total ADAMTS18.

ADAMTS18 Antibody
1-CSB-PA493628	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against ADAMTS18. Recognizes ADAMTS18 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC-p:1:100-1:300.ELISA:1/10000

ADAMTS18 antibody
70R-4602	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal ADAMTS18 antibody raised against the N terminal of ADAMTS18

ADAMTS18 antibody
70R-33996	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal ADAMTS18 antibody

ADAMTS18 siRNA
20-abx906758	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

ADAMTS18 siRNA
20-abx906759	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

ADAMTS18 Antibody
ABD3740	Lifescience Market	100 ug	EUR 438

anti-ADAMTS18
YF-PA22638	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to ADAMTS18

ADAMTS18 Blocking Peptide
33R-3140	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ADAMTS18 antibody, catalog no. 70R-4602

ADAMTS18 Blocking Peptide
DF3740-BP	Affbiotech	1mg	EUR 195

ADAMTS18 Blocking Peptide
20-abx161008	Abbexa	EUR 272.00 EUR 411.00	1 mg 5 mg
Shipped within 5-10 working days.

ADAMTS18 Conjugated Antibody
C34387	SAB	100ul	EUR 397

ADAMTS18 cloning plasmid
CSB-CL851556HU-10ug	Cusabio	10ug	EUR 1294
Formulation: 10 μg plasmid + 200μl Glycerol Length: 3666 Sequence: atggagtgcgccctcctgctcgcgtgtgccttcccggctgcgggttcgggcccgccgaggggcctggcgggactggggcgcgtggccaaggcgctccagctgtgctgcctctgctgtgcgtcggtcgccgcggccttagccagtgacagcagcagcggcgccagcggattaaatg Show more
Description: A cloning plasmid for the ADAMTS18 gene.

Human ADAMTS18 ELISA Kit
ELA-E4831h	Lifescience Market	96 Tests	EUR 824

Human ADAMTS18 ELISA KIT
ELI-11463h	Lifescience Market	96 Tests	EUR 824

ADAMTS18 ELISA KIT|Human
EF006359	Lifescience Market	96 Tests	EUR 689

Human ADAMTS18 shRNA Plasmid
20-abx966125	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse ADAMTS18 shRNA Plasmid
20-abx980584	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse Adamts18 ELISA KIT
ELI-33373m	Lifescience Market	96 Tests	EUR 865

Adamts18 ORF Vector (Rat) (pORF)
ORF063066	ABM	1.0 ug DNA	EUR 506

ADAMTS18 ORF Vector (Human) (pORF)
ORF000179	ABM	1.0 ug DNA	EUR 95

Adamts18 ORF Vector (Mouse) (pORF)
ORF038104	ABM	1.0 ug DNA	EUR 506

ADAMTS18 ELISA Kit (Mouse) (OKEH05099)
OKEH05099	Aviva Systems Biology	96 Wells	EUR 727
Description: Description of target: ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 39.2 pg/mL

ADAMTS18 ELISA Kit (Human) (OKEH01736)
OKEH01736	Aviva Systems Biology	96 Wells	EUR 727
Description: Description of target: This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. ADAMTS family members share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The protein encoded by this gene has a high sequence similarity to the protein encoded by gene ADAMTS16, another family member. It is thought to function as a tumor suppressor. Alternatively spliced transcript variants have been identified, but their biological validity has not been determined.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 34 pg/mL

Adamts18 sgRNA CRISPR Lentivector set (Rat)
K6191801	ABM	3 x 1.0 ug	EUR 339

ADAMTS18 sgRNA CRISPR Lentivector set (Human)
K0045201	ABM	3 x 1.0 ug	EUR 339

Adamts18 sgRNA CRISPR Lentivector set (Mouse)
K3868201	ABM	3 x 1.0 ug	EUR 339

Adamts18 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6191802	ABM	1.0 ug DNA	EUR 154

Adamts18 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6191803	ABM	1.0 ug DNA	EUR 154

Adamts18 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6191804	ABM	1.0 ug DNA	EUR 154

ADAMTS18 sgRNA CRISPR Lentivector (Human) (Target 1)
K0045202	ABM	1.0 ug DNA	EUR 154

ADAMTS18 sgRNA CRISPR Lentivector (Human) (Target 2)
K0045203	ABM	1.0 ug DNA	EUR 154

ADAMTS18 sgRNA CRISPR Lentivector (Human) (Target 3)
K0045204	ABM	1.0 ug DNA	EUR 154

Adamts18 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3868202	ABM	1.0 ug DNA	EUR 154

Adamts18 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3868203	ABM	1.0 ug DNA	EUR 154

Adamts18 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3868204	ABM	1.0 ug DNA	EUR 154

ADAMTS18 Protein Vector (Mouse) (pPB-C-His)
PV152414	ABM	500 ng	EUR 1065

ADAMTS18 Protein Vector (Mouse) (pPB-N-His)
PV152415	ABM	500 ng	EUR 1065

ADAMTS18 Protein Vector (Mouse) (pPM-C-HA)
PV152416	ABM	500 ng	EUR 1065

ADAMTS18 Protein Vector (Mouse) (pPM-C-His)
PV152417	ABM	500 ng	EUR 1065

ADAMTS18 Protein Vector (Rat) (pPB-C-His)
PV252262	ABM	500 ng	EUR 1166

ADAMTS18 Protein Vector (Rat) (pPB-N-His)
PV252263	ABM	500 ng	EUR 1166

ADAMTS18 Protein Vector (Rat) (pPM-C-HA)
PV252264	ABM	500 ng	EUR 1166

ADAMTS18 Protein Vector (Rat) (pPM-C-His)
PV252265	ABM	500 ng	EUR 1166

ADAMTS18 Protein Vector (Human) (pPB-His-MBP)
PV319866	ABM	500 ng	EUR 329

ADAMTS18 Protein Vector (Human) (pPB-His-GST)
PV319867	ABM	500 ng	EUR 329

ADAMTS18 Protein Vector (Human) (pPB-C-His)
PV000713	ABM	500 ng	EUR 329

ADAMTS18 Protein Vector (Human) (pPB-N-His)
PV000714	ABM	500 ng	EUR 329

ADAMTS18 Protein Vector (Human) (pPM-C-HA)
PV000715	ABM	500 ng	EUR 329

ADAMTS18 Protein Vector (Human) (pPM-C-His)
PV000716	ABM	500 ng	EUR 329

Adamts18 3'UTR Luciferase Stable Cell Line
TU101393	ABM	1.0 ml	Ask for price

Adamts18 3'UTR GFP Stable Cell Line
TU151393	ABM	1.0 ml	Ask for price

Adamts18 3'UTR Luciferase Stable Cell Line
TU200277	ABM	1.0 ml	Ask for price

Adamts18 3'UTR GFP Stable Cell Line
TU250277	ABM	1.0 ml	Ask for price

ADAMTS18 3'UTR GFP Stable Cell Line
TU050332	ABM	1.0 ml	EUR 4617

ADAMTS18 3'UTR Luciferase Stable Cell Line
TU000332	ABM	1.0 ml	EUR 4617

ADAMTS18 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV650521	ABM	1.0 ug DNA	EUR 1355

ADAMTS18 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV650525	ABM	1.0 ug DNA	EUR 1355

ADAMTS18 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV650526	ABM	1.0 ug DNA	EUR 1355

Adamts18 ELISA Kit| Mouse A disintegrin and metalloproteinase w
EF014135	Lifescience Market	96 Tests	EUR 689

ADAMTS18 Protein Vector (Human) (pPM-N-D-C-HA)
PV319868	ABM	500 ng	EUR 329

ADAMTS18 Protein Vector (Human) (pPM-N-D-C-His)
PV319869	ABM	500 ng	EUR 329

Human A disintegrin and metalloproteinase with thrombospondin motifs 18 (ADAMTS18)
1-CSB-EP851556HU	Cusabio	EUR 505.00 EUR 265.00 EUR 1827.00 EUR 766.00 EUR 1218.00 EUR 335.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 15.5 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18),partial expressed in E.coli

ADAM Metallopeptidase With Thrombospondin Type 1 Motif 18 (ADAMTS18) Antibody
20-abx212036	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

ADAM Metallopeptidase With Thrombospondin Type 1 Motif 18 (ADAMTS18) Antibody
20-abx212832	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

ADAM Metallopeptidase With Thrombospondin Type 1 Motif 18 (ADAMTS18) Antibody
20-abx121008	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

ADAM Metallopeptidase With Thrombospondin Type 1 Motif 18 (ADAMTS18) Antibody
abx038097-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

ADAM Metallopeptidase With Thrombospondin Type 1 Motif 18 (ADAMTS18) Antibody
20-abx014155	Abbexa	EUR 314.00 EUR 98.00 EUR 398.00 EUR 495.00	100 ug 10 ug 200 ug 300 µg
Shipped within 5-10 working days.

ADAM Metallopeptidase With Thrombospondin Type 1 Motif 18 (ADAMTS18) Antibody
abx331727-100ul	Abbexa	100 ul	EUR 425
Shipped within 5-10 working days.

ADAM Metallopeptidase With Thrombospondin Type 1 Motif 18 (ADAMTS18) Antibody
20-abx326245	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Adamts18 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K6191805	ABM	3 x 1.0 ug	EUR 376

ADAMTS18 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K0045205	ABM	3 x 1.0 ug	EUR 376

Adamts18 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K3868205	ABM	3 x 1.0 ug	EUR 376

ADAMTS18 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)
LV650522	ABM	1.0 ug DNA	EUR 1355

ADAMTS18 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)
LV650523	ABM	1.0 ug DNA	EUR 1413

ADAMTS18 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)
LV650524	ABM	1.0 ug DNA	EUR 1413

Adamts18 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K6191806	ABM	1.0 ug DNA	EUR 167

Adamts18 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)
K6191807	ABM	1.0 ug DNA	EUR 167

Adamts18 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)
K6191808	ABM	1.0 ug DNA	EUR 167

ADAMTS18 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K0045206	ABM	1.0 ug DNA	EUR 167

ADAMTS18 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K0045207	ABM	1.0 ug DNA	EUR 167

ADAMTS18 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K0045208	ABM	1.0 ug DNA	EUR 167

Adamts18 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K3868206	ABM	1.0 ug DNA	EUR 167

Adamts18 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K3868207	ABM	1.0 ug DNA	EUR 167

Adamts18 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K3868208	ABM	1.0 ug DNA	EUR 167

ELISA kit for Human ADAMTS18 (A Disintegrin And Metalloproteinase With Thrombospondin 18)
E-EL-H5602	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's ADAMTS18 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human ADAMTS18. Standards or samples are added to the micro ELISA plate wells and combined Show more
Description: A sandwich ELISA kit for quantitative measurement of Human ADAMTS18 (A Disintegrin And Metalloproteinase With Thrombospondin 18) in samples from Serum, Plasma, Cell supernatant

Mouse Adamts18/ A disintegrin and metalloproteinase with thrombospondin motifs 18 ELISA Kit
E0034Mo	Sunlong	1 Kit	EUR 632

Human ADAMTS18/ A disintegrin and metalloproteinase with thrombospondin motifs 18 ELISA Kit
E0052Hu	Sunlong	1 Kit	EUR 605

Rat A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) ELISA kit
E02A0935-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) ELISA kit
E02A0935-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) ELISA kit
E02A0935-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) ELISA kit
E04A0935-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) ELISA kit
E04A0935-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) ELISA kit
E04A0935-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) ELISA kit
E06A0935-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) ELISA kit
E06A0935-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) ELISA kit
E06A0935-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) ELISA kit
E03A0935-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) ELISA kit
E03A0935-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) ELISA kit
E03A0935-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) ELISA kit
E01A0935-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) ELISA kit
E01A0935-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) ELISA kit
E01A0935-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human ADAM Metallopeptidase With Thrombospondin Type 1 Motif 18 (ADAMTS18) ELISA Kit
abx251648-96tests	Abbexa	96 tests	EUR 754
Shipped within 5-12 working days.

Dog A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) ELISA kit
E08A0935-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) ELISA kit
E08A0935-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) ELISA kit
E08A0935-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) ELISA kit
E09A0935-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) ELISA kit
E09A0935-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) ELISA kit
E09A0935-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human ADAMTS18(A disintegrin and metalloproteinase with thrombospondin motifs 18) ELISA Kit
EH2297	FN Test	96T	EUR 567.6
Detection range: 78-5000 pg/ml Uniprot ID: Q8TE60 Alias: ADAMTS18/ADAM-TS 18/ADAM-TS18/ADAMTS-18/ADAMTS18/ADAMTS21/3.4.24.-
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.9pg/ml

Pig A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) ELISA kit
E07A0935-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) ELISA kit
E07A0935-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) ELISA kit
E07A0935-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) ELISA kit
CSB-EL001306HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human A disintegrin and metalloproteinase with thrombospondin motifs 18 (ADAMTS18) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) ELISA kit
1-CSB-EL001306HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human ADAM Metallopeptidase With Thrombospondin Type 1 Motif 18 (ADAMTS18) ELISA Kit
abx520409-96tests	Abbexa	96 tests	EUR 754
Shipped within 5-12 working days.

Mouse ADAM Metallopeptidase With Thrombospondin Type 1 Motif 18 (ADAMTS18) ELISA Kit
abx520410-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Guinea pig A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) ELISA kit
E05A0935-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) ELISA kit
E05A0935-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) ELISA kit
E05A0935-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

A scoping review of post-partum pharmaceutical lactation inhibition specific for WLWH was conducted using searches in PubMed, Medline Ovid, EBM Reviews Ovid, Embase, Web of Science and Scopus until 2019.

A narrative review of cabergoline pharmacologic properties, therapeutic efficacy, tolerability data and drug interaction data relevant to lactation inhibition was then conducted. Among 1366 articles, the scoping review identified 13 relevant publications.

Eight guidelines providing guidance regarding lactation inhibition for WLWH and two surveys of medical practice on this topic in UK have been published.