Cabergoline: a review of its use in the inhibition of lactation for women living with HIV.

In developed countries, breastfeeding is not recommended for women living with human immunodeficiency virus (WLWH). However, lactation symptoms can be distressing for women who choose not to breastfeed.

There is currently no universal guideline on the most appropriate options for prevention or reduction of lactation symptoms amongst WLWH. This review describes the evidence base for using cabergoline, a dopaminergic agonist, for the post-partum inhibition of lactation for WLWH.

ADAMTS18 antibody

70R-4602 50 ug
EUR 467
Description: Rabbit polyclonal ADAMTS18 antibody raised against the N terminal of ADAMTS18

ADAMTS18 antibody

70R-33996 100 ug
EUR 327
Description: Rabbit polyclonal ADAMTS18 antibody

ADAMTS18 Antibody

ABD3740 100 ug
EUR 438

ADAMTS18 Antibody

34387-100ul 100ul
EUR 252

ADAMTS18 Antibody

34387-50ul 50ul
EUR 187

ADAMTS18 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ADAMTS18. Recognizes ADAMTS18 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

ADAMTS18 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ADAMTS18. Recognizes ADAMTS18 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000

ADAMTS18 Antibody

EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against ADAMTS18. Recognizes ADAMTS18 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

ADAMTS18 Antibody

CSB-PA999160-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against ADAMTS18. Recognizes ADAMTS18 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

ADAMTS18 Antibody

DF3740 200ul
EUR 304
Description: ADAMTS18 Antibody detects endogenous levels of total ADAMTS18.

ADAMTS18 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against ADAMTS18. Recognizes ADAMTS18 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC-p:1:100-1:300.ELISA:1/10000


YF-PA22638 50 ug
EUR 363
Description: Mouse polyclonal to ADAMTS18

ADAMTS18 Conjugated Antibody

C34387 100ul
EUR 397

ADAMTS18 Blocking Peptide

  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

ADAMTS18 Blocking Peptide

33R-3140 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ADAMTS18 antibody, catalog no. 70R-4602

ADAMTS18 Blocking Peptide

DF3740-BP 1mg
EUR 195

ADAMTS18 cloning plasmid

CSB-CL851556HU-10ug 10ug
EUR 1294
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3666
  • Sequence: atggagtgcgccctcctgctcgcgtgtgccttcccggctgcgggttcgggcccgccgaggggcctggcgggactggggcgcgtggccaaggcgctccagctgtgctgcctctgctgtgcgtcggtcgccgcggccttagccagtgacagcagcagcggcgccagcggattaaatg
  • Show more
Description: A cloning plasmid for the ADAMTS18 gene.

Mouse ADAMTS18 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human ADAMTS18 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


ELA-E4831h 96 Tests
EUR 824


ELI-11463h 96 Tests
EUR 824


EF006359 96 Tests
EUR 689

Mouse Adamts18 ELISA KIT

ELI-33373m 96 Tests
EUR 865

ADAMTS18 ORF Vector (Human) (pORF)

ORF000179 1.0 ug DNA
EUR 95

Adamts18 ORF Vector (Mouse) (pORF)

ORF038104 1.0 ug DNA
EUR 506

Adamts18 ORF Vector (Rat) (pORF)

ORF063066 1.0 ug DNA
EUR 506

ADAMTS18 ELISA Kit (Human) (OKEH01736)

OKEH01736 96 Wells
EUR 727
Description: Description of target: This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. ADAMTS family members share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The protein encoded by this gene has a high sequence similarity to the protein encoded by gene ADAMTS16, another family member. It is thought to function as a tumor suppressor. Alternatively spliced transcript variants have been identified, but their biological validity has not been determined.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 34 pg/mL

ADAMTS18 ELISA Kit (Mouse) (OKEH05099)

OKEH05099 96 Wells
EUR 727
Description: Description of target: ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 39.2 pg/mL

ADAMTS18 sgRNA CRISPR Lentivector set (Human)

K0045201 3 x 1.0 ug
EUR 339

Adamts18 sgRNA CRISPR Lentivector set (Mouse)

K3868201 3 x 1.0 ug
EUR 339

Adamts18 sgRNA CRISPR Lentivector set (Rat)

K6191801 3 x 1.0 ug
EUR 339

ADAMTS18 sgRNA CRISPR Lentivector (Human) (Target 1)

K0045202 1.0 ug DNA
EUR 154

ADAMTS18 sgRNA CRISPR Lentivector (Human) (Target 2)

K0045203 1.0 ug DNA
EUR 154

ADAMTS18 sgRNA CRISPR Lentivector (Human) (Target 3)

K0045204 1.0 ug DNA
EUR 154

Adamts18 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3868202 1.0 ug DNA
EUR 154

Adamts18 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3868203 1.0 ug DNA
EUR 154

Adamts18 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3868204 1.0 ug DNA
EUR 154

Adamts18 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6191802 1.0 ug DNA
EUR 154

Adamts18 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6191803 1.0 ug DNA
EUR 154

Adamts18 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6191804 1.0 ug DNA
EUR 154

ADAMTS18 Protein Vector (Human) (pPB-C-His)

PV000713 500 ng
EUR 329

ADAMTS18 Protein Vector (Human) (pPB-N-His)

PV000714 500 ng
EUR 329

ADAMTS18 Protein Vector (Human) (pPM-C-HA)

PV000715 500 ng
EUR 329

ADAMTS18 Protein Vector (Human) (pPM-C-His)

PV000716 500 ng
EUR 329

ADAMTS18 Protein Vector (Human) (pPB-His-MBP)

PV319866 500 ng
EUR 329

ADAMTS18 Protein Vector (Human) (pPB-His-GST)

PV319867 500 ng
EUR 329

ADAMTS18 Protein Vector (Mouse) (pPB-C-His)

PV152414 500 ng
EUR 1065

ADAMTS18 Protein Vector (Mouse) (pPB-N-His)

PV152415 500 ng
EUR 1065

ADAMTS18 Protein Vector (Mouse) (pPM-C-HA)

PV152416 500 ng
EUR 1065

ADAMTS18 Protein Vector (Mouse) (pPM-C-His)

PV152417 500 ng
EUR 1065

ADAMTS18 Protein Vector (Rat) (pPB-C-His)

PV252262 500 ng
EUR 1166

ADAMTS18 Protein Vector (Rat) (pPB-N-His)

PV252263 500 ng
EUR 1166

ADAMTS18 Protein Vector (Rat) (pPM-C-HA)

PV252264 500 ng
EUR 1166

ADAMTS18 Protein Vector (Rat) (pPM-C-His)

PV252265 500 ng
EUR 1166

Adamts18 3'UTR Luciferase Stable Cell Line

TU200277 1.0 ml Ask for price

Adamts18 3'UTR GFP Stable Cell Line

TU151393 1.0 ml Ask for price

ADAMTS18 3'UTR Luciferase Stable Cell Line

TU000332 1.0 ml
EUR 4617

Adamts18 3'UTR Luciferase Stable Cell Line

TU101393 1.0 ml Ask for price

ADAMTS18 3'UTR GFP Stable Cell Line

TU050332 1.0 ml
EUR 4617

Adamts18 3'UTR GFP Stable Cell Line

TU250277 1.0 ml Ask for price

ADAMTS18 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV650521 1.0 ug DNA
EUR 1355

ADAMTS18 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV650525 1.0 ug DNA
EUR 1355

ADAMTS18 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV650526 1.0 ug DNA
EUR 1355

Adamts18 ELISA Kit| Mouse A disintegrin and metalloproteinase w

EF014135 96 Tests
EUR 689

ADAMTS18 Protein Vector (Human) (pPM-N-D-C-HA)

PV319868 500 ng
EUR 329

ADAMTS18 Protein Vector (Human) (pPM-N-D-C-His)

PV319869 500 ng
EUR 329

ADAMTS18 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0045205 3 x 1.0 ug
EUR 376

ADAM Metallopeptidase With Thrombospondin Type 1 Motif 18 (ADAMTS18) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

ADAM Metallopeptidase With Thrombospondin Type 1 Motif 18 (ADAMTS18) Antibody

abx038097-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

ADAM Metallopeptidase With Thrombospondin Type 1 Motif 18 (ADAMTS18) Antibody

  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

ADAM Metallopeptidase With Thrombospondin Type 1 Motif 18 (ADAMTS18) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

ADAM Metallopeptidase With Thrombospondin Type 1 Motif 18 (ADAMTS18) Antibody

abx331727-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

ADAM Metallopeptidase With Thrombospondin Type 1 Motif 18 (ADAMTS18) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

ADAM Metallopeptidase With Thrombospondin Type 1 Motif 18 (ADAMTS18) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Adamts18 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K3868205 3 x 1.0 ug
EUR 376

Adamts18 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6191805 3 x 1.0 ug
EUR 376

Human A disintegrin and metalloproteinase with thrombospondin motifs 18 (ADAMTS18)

  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 15.5 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18),partial expressed in E.coli

ADAMTS18 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K0045206 1.0 ug DNA
EUR 167

ADAMTS18 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K0045207 1.0 ug DNA
EUR 167

ADAMTS18 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K0045208 1.0 ug DNA
EUR 167

Adamts18 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K3868206 1.0 ug DNA
EUR 167

Adamts18 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K3868207 1.0 ug DNA
EUR 167

Adamts18 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K3868208 1.0 ug DNA
EUR 167

Adamts18 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K6191806 1.0 ug DNA
EUR 167

Adamts18 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K6191807 1.0 ug DNA
EUR 167

Adamts18 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K6191808 1.0 ug DNA
EUR 167

ADAMTS18 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV650522 1.0 ug DNA
EUR 1355

ADAMTS18 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV650523 1.0 ug DNA
EUR 1413

ADAMTS18 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV650524 1.0 ug DNA
EUR 1413

Human ADAM Metallopeptidase With Thrombospondin Type 1 Motif 18 (ADAMTS18) ELISA Kit

abx520409-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

Mouse ADAM Metallopeptidase With Thrombospondin Type 1 Motif 18 (ADAMTS18) ELISA Kit

abx520410-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

ELISA kit for Human ADAMTS18 (A Disintegrin And Metalloproteinase With Thrombospondin 18)

E-EL-H5602 1 plate of 96 wells
EUR 534
  • Gentaur's ADAMTS18 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human ADAMTS18. Standards or samples are added to the micro ELISA plate wells and combined
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human ADAMTS18 (A Disintegrin And Metalloproteinase With Thrombospondin 18) in samples from Serum, Plasma, Cell supernatant

Goat A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) ELISA kit

E06A0935-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) ELISA kit

E06A0935-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) ELISA kit

E06A0935-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) ELISA kit

E02A0935-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) ELISA kit

E02A0935-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) ELISA kit

E02A0935-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) ELISA kit

E03A0935-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) ELISA kit

E03A0935-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) ELISA kit

E03A0935-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) ELISA kit

E04A0935-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) ELISA kit

E04A0935-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) ELISA kit

E04A0935-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) ELISA kit

E01A0935-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) ELISA kit

E01A0935-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) ELISA kit

E01A0935-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) ELISA kit

E08A0935-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) ELISA kit

E08A0935-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) ELISA kit

E08A0935-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) ELISA kit

E07A0935-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) ELISA kit

E07A0935-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) ELISA kit

E07A0935-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) ELISA kit

E09A0935-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) ELISA kit

E09A0935-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) ELISA kit

E09A0935-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human ADAMTS18(A disintegrin and metalloproteinase with thrombospondin motifs 18) ELISA Kit

EH2297 96T
EUR 567.6
  • Detection range: 78-5000 pg/ml
  • Uniprot ID: Q8TE60
  • Alias: ADAMTS18/ADAM-TS 18/ADAM-TS18/ADAMTS-18/ADAMTS18/ADAMTS21/3.4.24.-
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.9pg/ml

Human ADAM Metallopeptidase With Thrombospondin Type 1 Motif 18 (ADAMTS18) ELISA Kit

abx251648-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

Human A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) ELISA kit

CSB-EL001306HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human A disintegrin and metalloproteinase with thrombospondin motifs 18 (ADAMTS18) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) ELISA kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Mouse Adamts18/ A disintegrin and metalloproteinase with thrombospondin motifs 18 ELISA Kit

E0034Mo 1 Kit
EUR 632

Human ADAMTS18/ A disintegrin and metalloproteinase with thrombospondin motifs 18 ELISA Kit

E0052Hu 1 Kit
EUR 605

Guinea pig A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) ELISA kit

E05A0935-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) ELISA kit

E05A0935-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) ELISA kit

E05A0935-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig A disintegrin and metalloproteinase with thrombospondin motifs 18(ADAMTS18) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

A scoping review of post-partum pharmaceutical lactation inhibition specific for WLWH was conducted using searches in PubMed, Medline Ovid, EBM Reviews Ovid, Embase, Web of Science and Scopus until 2019.

A narrative review of cabergoline pharmacologic properties, therapeutic efficacy, tolerability data and drug interaction data relevant to lactation inhibition was then conducted. Among 1366 articles, the scoping review identified 13 relevant publications.

Eight guidelines providing guidance regarding lactation inhibition for WLWH and two surveys of medical practice on this topic in UK have been published.