Real-world evidence vs EBM: what does real-world data add?

Although randomized medical trials (RCTs) provide the very best degree of scientific evidence, they’re unable to guage the impression of therapies within the routine medical follow. The heterogeneity of socio-demographic and medical traits of sufferers, in addition to the complexity of therapies, clarify the hole between the impact noticed in RCTs and its impression within the real-world setting.
As in comparison with typical trials, pragmatic RCTs are carried out in a setting as comparable as attainable to that of medical follow, however they aren’t at all times in a position to slim this hole. For this causes, strategies aimed to provide evidence on the impression of healthcare pathways within the real-world (i.e., real-world evidence) are of rising curiosity.
In specific, these primarily based on the Electronic Healthcare Utilization (EHU), together with administrative databases on the healthcare companies offered to beneficiaries of the National Health System, are receiving growing consideration from each the scientific group and healthcare decision-makers. In this text, we described traits and analysis areas the place EHU databases could also be notably helpful, together with strengths and limits of this strategy. In conclusion, EHU data mustn’t substitute RCTs, however they characterize a robust device for integrating RCTs and for supporting healthcare decision-makers.

Finite factor evaluation of EBM manufactured bespoke implants: A probabilistic examine

This examine analyses three additively manufactured canine implants designed for angular limb deformity correction process by means of probabilistic numerical evaluation. These implants have produced glorious outcomes in-vivo and are operational to-date. Therefore, this examine makes use of finite factor evaluation along side statistical evaluation with a purpose to additional validate these implants from a numerical perspective. Due to uncertainties related to boundary situations for a bespoke implant geometry, the analyses on this examine have been carried out on a variety of enter values.
An interrogation of those parameters by means of sensitivity evaluation enabled in figuring out the important inputs. These inputs have been then employed to conduct robustness evaluation with a purpose to decide the imply worth of stress on which these implants ideally function. These imply values have been then in contrast with the related security and failure restrict to acquire the chance of reaching these limits by means of totally different reliability methods. A low chance of failure computed from numerical evaluation together with the continued efficiency of those implants, suggests a profitable integration of the methodology within the design part of bespoke implants.

Monotonic and Fatigue Behavior of EBM Manufactured Ti-6Al-4V Solid Samples: Experimental, Analytical and Numerical Investigations

The current examine goals to hold out an experimental, analytical and numerical investigation of the monotonic and fatigue efficiency of electron beam melted Ti-6Al-4V buildings. Therefore, tensile exams, a number of step exams and strain-life exams have been carried out on machined EBM Ti-6Al-4V strong samples. An elastic-plastic materials mannequin together with a numerical harm mannequin was examined in accordance with the experimental tensile exams. Analytical fashions proposed by Ramberg and Osgood, in addition to Coffin and Manson have been obtained to explain the cyclic stress-strain curves and strain-life curves, respectively.
The fracture surfaces of the examined samples and the affect of various construct instructions have been analyzed. A prediction of the static and fatigue materials properties is of specific significance, e.g., for the protected software of additively manufactured load-bearing implant buildings. Based on the decided analytical and numerical fashions, the fabric and product habits of complicated electron beam melted buildings underneath cyclic loading and fatigue life willpower might be investigated within the early phases of the product improvement course of.
Real-world evidence vs EBM: what does real-world data add?

EBM+: Advancing Evidence-Based Medicine through two degree automated identification of Populations, Interventions, Outcomes in medical literature

Evidence-Based Medicine (EBM) has been an vital follow for medical practitioners. However, because the variety of medical publications will increase dramatically, it’s turning into extraordinarily troublesome for medical consultants to evaluation all of the contents accessible and make an informative therapy plan for his or her sufferers. Quite a lot of frameworks, together with the PICO framework which is known as after its parts (Population, Intervention, Comparison, Outcome), have been developed to allow fine-grained searches, as step one to sooner choice making. In this work, we suggest a novel entity recognition system that identifies PICO entities inside medical publications and achieves state-of-the-art efficiency within the activity.
This is achieved by the mix of 4 2D Convolutional Neural Networks (CNNs) for character function extraction, and a Highway Residual connection to facilitate deep Neural Network architectures. We additional introduce a PICO Statement classifier, that identifies sentences that not solely include all PICO entities but additionally reply questions acknowledged in PICO. To facilitate this activity we additionally introduce a top quality dataset, manually annotated by medical practitioners. With the mix of our proposed PICO Entity Recognizer and PICO Statement classifier we purpose to advance EBM and allow its sooner and extra correct follow.

The Impact of the Media and Environmental Pollution on the Economy and Health Using a Modified Meta 2-Stage EBM Malmquist Model

China’s pursuit of financial progress, fast industrialization, and urbanization over the previous few a long time has resulted in excessive power consumption, which in flip has precipitated severe environmental air pollution issues, similar to CO2 and PM2.5 emissions, the long-term publicity to which might significantly have an effect on resident well being. To resolve these air air pollution issues, the Chinese authorities has put in place a number of insurance policies to scale back air and environmental air pollution.
Past research on power and environmental effectivity have been principally static, have ignored the dynamic adjustments over time and regional variations, and have hardly ever thought of human well being elements. Therefore, this examine employed a modified meta 2-stage Epsilon-Based Measure (EBM) Malmquist mannequin to discover the relationships between the financial system, power, the setting, well being and media, and the regional variations in 31 Chinese cities from 2014 to 2016.

CD68(CD68/G2) Antibody

BNC040919-100 100uL
EUR 199
Description: Primary antibody against CD68(CD68/G2), CF405S conjugate, Concentration: 0.1mg/mL

CD68(CD68/G2) Antibody

BNC040919-500 500uL
EUR 544
Description: Primary antibody against CD68(CD68/G2), CF405S conjugate, Concentration: 0.1mg/mL

CD68(CD68/G2) Antibody

BNC550919-100 100uL
EUR 199
Description: Primary antibody against CD68(CD68/G2), CF555 conjugate, Concentration: 0.1mg/mL

CD68(CD68/G2) Antibody

BNC550919-500 500uL
EUR 544
Description: Primary antibody against CD68(CD68/G2), CF555 conjugate, Concentration: 0.1mg/mL

CD68(CD68/G2) Antibody

BNC610919-100 100uL
EUR 199
Description: Primary antibody against CD68(CD68/G2), CF660R conjugate, Concentration: 0.1mg/mL

CD68(CD68/G2) Antibody

BNC610919-500 500uL
EUR 544
Description: Primary antibody against CD68(CD68/G2), CF660R conjugate, Concentration: 0.1mg/mL

CD68(CD68/G2) Antibody

BNC470919-100 100uL
EUR 199
Description: Primary antibody against CD68(CD68/G2), CF647 conjugate, Concentration: 0.1mg/mL

CD68(CD68/G2) Antibody

BNC470919-500 500uL
EUR 544
Description: Primary antibody against CD68(CD68/G2), CF647 conjugate, Concentration: 0.1mg/mL

CD68(CD68/G2) Antibody

BNC050919-100 100uL
EUR 199
Description: Primary antibody against CD68(CD68/G2), CF405M conjugate, Concentration: 0.1mg/mL

CD68(CD68/G2) Antibody

BNC050919-500 500uL
EUR 544
Description: Primary antibody against CD68(CD68/G2), CF405M conjugate, Concentration: 0.1mg/mL

CD68(CD68/G2) Antibody

BNC400919-100 100uL
EUR 199
Description: Primary antibody against CD68(CD68/G2), CF640R conjugate, Concentration: 0.1mg/mL

CD68(CD68/G2) Antibody

BNC400919-500 500uL
EUR 544
Description: Primary antibody against CD68(CD68/G2), CF640R conjugate, Concentration: 0.1mg/mL

CD68(CD68/G2) Antibody

BNC430919-100 100uL
EUR 199
Description: Primary antibody against CD68(CD68/G2), CF543 conjugate, Concentration: 0.1mg/mL

CD68(CD68/G2) Antibody

BNC430919-500 500uL
EUR 544
Description: Primary antibody against CD68(CD68/G2), CF543 conjugate, Concentration: 0.1mg/mL

CD68(CD68/G2) Antibody

BNC800919-100 100uL
EUR 199
Description: Primary antibody against CD68(CD68/G2), CF680 conjugate, Concentration: 0.1mg/mL

CD68(CD68/G2) Antibody

BNC800919-500 500uL
EUR 544
Description: Primary antibody against CD68(CD68/G2), CF680 conjugate, Concentration: 0.1mg/mL

CD68(CD68/G2) Antibody

BNCP0919-250 250uL
EUR 383
Description: Primary antibody against CD68(CD68/G2), PerCP conjugate, Concentration: 0.1mg/mL

CD68(CD68/G2) Antibody

BNCR0919-250 250uL
EUR 383
Description: Primary antibody against CD68(CD68/G2), RPE conjugate, Concentration: 0.1mg/mL

CD68(CD68/G2) Antibody

BNCA0919-250 250uL
EUR 383
Description: Primary antibody against CD68(CD68/G2), APC conjugate, Concentration: 0.1mg/mL

CD68(CD68/G2) Antibody

BNCAP0919-100 100uL
EUR 199
Description: Primary antibody against CD68(CD68/G2), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

CD68(CD68/G2) Antibody

BNCAP0919-500 500uL
EUR 544
Description: Primary antibody against CD68(CD68/G2), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

CD68(CD68/G2) Antibody

BNCB0919-100 100uL
EUR 199
Description: Primary antibody against CD68(CD68/G2), Biotin conjugate, Concentration: 0.1mg/mL

CD68(CD68/G2) Antibody

BNCB0919-500 500uL
EUR 544
Description: Primary antibody against CD68(CD68/G2), Biotin conjugate, Concentration: 0.1mg/mL

CD68(CD68/G2) Antibody

BNCH0919-100 100uL
EUR 199
Description: Primary antibody against CD68(CD68/G2), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

CD68(CD68/G2) Antibody

BNCH0919-500 500uL
EUR 544
Description: Primary antibody against CD68(CD68/G2), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

CD68(CD68/G2) Antibody

BNC880919-100 100uL
EUR 199
Description: Primary antibody against CD68(CD68/G2), CF488A conjugate, Concentration: 0.1mg/mL

CD68(CD68/G2) Antibody

BNC880919-500 500uL
EUR 544
Description: Primary antibody against CD68(CD68/G2), CF488A conjugate, Concentration: 0.1mg/mL

CD68(CD68/G2) Antibody

BNC940919-100 100uL
EUR 199
Description: Primary antibody against CD68(CD68/G2), CF594 conjugate, Concentration: 0.1mg/mL

CD68(CD68/G2) Antibody

BNC940919-500 500uL
EUR 544
Description: Primary antibody against CD68(CD68/G2), CF594 conjugate, Concentration: 0.1mg/mL

CD68(CD68/G2) Antibody

BNC680919-100 100uL
EUR 199
Description: Primary antibody against CD68(CD68/G2), CF568 conjugate, Concentration: 0.1mg/mL

CD68(CD68/G2) Antibody

BNC680919-500 500uL
EUR 544
Description: Primary antibody against CD68(CD68/G2), CF568 conjugate, Concentration: 0.1mg/mL

CD68(CD68/G2) Antibody

BNC700919-100 100uL
EUR 199
Description: Primary antibody against CD68(CD68/G2), CF770 conjugate, Concentration: 0.1mg/mL

CD68(CD68/G2) Antibody

BNC700919-500 500uL
EUR 544
Description: Primary antibody against CD68(CD68/G2), CF770 conjugate, Concentration: 0.1mg/mL

CD68(CD68/G2) Antibody

BNC810919-100 100uL
EUR 199
Description: Primary antibody against CD68(CD68/G2), CF680R conjugate, Concentration: 0.1mg/mL

CD68(CD68/G2) Antibody

BNC810919-500 500uL
EUR 544
Description: Primary antibody against CD68(CD68/G2), CF680R conjugate, Concentration: 0.1mg/mL

Rat CD68(CD68) ELISA Kit

QY-E11740 96T
EUR 374

CD68 antibody

70R-21478 50 ul
EUR 435
Description: Rabbit polyclonal CD68 antibody

CD68 antibody

70R-14057 100 ug
EUR 305
Description: Affinity purified Rabbit polyclonal CD68 antibody

CD68 Antibody

35380-100ul 100ul
EUR 390

CD68 Antibody

37164-100ul 100ul
EUR 252

CD68 antibody

10R-2906 100 ul
EUR 370
Description: Mouse monoclonal CD68 antibody

CD68 antibody

10R-10864 500 ul
EUR 532
Description: Mouse monoclonal CD68 antibody

CD68 Antibody

49067-100ul 100ul
EUR 333

CD68 Antibody

49067-50ul 50ul
EUR 239

CD68 Antibody

1-CSB-PA004951ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CD68. Recognizes CD68 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

CD68 Antibody

1-CSB-PA004951GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against CD68. Recognizes CD68 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF

Cd68 Antibody

1-CSB-PA004951LA01MO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Cd68. Recognizes Cd68 from Mouse. This antibody is Unconjugated. Tested in the following application: ELISA

CD68 Antibody

1-CSB-PA005139
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CD68. Recognizes CD68 from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

CD68 Antibody

DF7518 200ul
EUR 304
Description: CD68 Antibody detects endogenous levels of total CD68.

CD68 Antibody

1-CSB-PA282654
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CD68. Recognizes CD68 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

CD68 Antibody

abx140493-100tests 100 tests
EUR 481
  • Shipped within 5-12 working days.

CD68 siRNA

20-abx911060
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CD68 Antibody

ABD7518 100 ug
EUR 438

pCDNA3.1-CD68

PVT18117 2 ug
EUR 258

anti-CD68

YF-PA10811 50 ug
EUR 363
Description: Mouse polyclonal to CD68

anti-CD68

YF-PA23401 50 ul
EUR 334
Description: Mouse polyclonal to CD68

CD68 (Macrophage Marker); Clone CD68/G2 (Concentrate)

RA0064-C.1 0.1 ml
EUR 125

CD68 (Macrophage Marker); Clone CD68/G2 (Concentrate)

RA0064-C.5 0.5 ml
EUR 300

Anti-CD68 Antibody Clone CD68/G2, Unconjugated-100ug

968-MSM5-P1 100ug
EUR 428

Monoclonal CD68 (Macrophage Marker) Antibody, Clone: CD68/G2

AMM01625G 7 ml
EUR 484
Description: A Monoclonal antibody against Human CD68 (Macrophage Marker). The antibodies are raised in Mouse and are from clone CD68/G2. This antibody is applicable in IHC, IF, FC

Recombinant Human CD68

7-04735 2µg Ask for price

Recombinant Human CD68

7-04736 5µg Ask for price

Recombinant Human CD68

7-04737 10µg Ask for price

CD68 Rabbit pAb

A13286-100ul 100 ul
EUR 308

CD68 Rabbit pAb

A13286-200ul 200 ul
EUR 459

CD68 Rabbit pAb

A13286-20ul 20 ul
EUR 183

CD68 Rabbit pAb

A13286-50ul 50 ul
EUR 223

CD68 Polyclonal Antibody

41618-100ul 100ul
EUR 252

CD68 Polyclonal Antibody

41618-50ul 50ul
EUR 187

CD68 ELISA kit

55R-2256 96 tests
EUR 1103
Description: ELISA Kit for detection of CD68 in the research laboratory

Mouse Macrosialin (Cd68)

1-CSB-EP004951MO
  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 44.8 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Macrosialin(Cd68),partial expressed in E.coli

Mouse Macrosialin (Cd68)

1-CSB-YP004951MO
  • EUR 504.00
  • EUR 265.00
  • EUR 1832.00
  • EUR 763.00
  • EUR 1216.00
  • EUR 334.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 30.8 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Macrosialin(Cd68),partial expressed in Yeast

CD68 Blocking Peptide

DF7518-BP 1mg
EUR 195

CD68, human recombinant

7343-50
EUR 479

Anti-CD68 Antibody

A00602 100ug/vial
EUR 294

Macrosialin (CD68) Antibody

20-abx006824
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Macrosialin (CD68) Antibody

abx016113-100ug 100 ug
EUR 411
  • Shipped within 5-10 working days.

Macrosialin (CD68) Antibody

20-abx004224
  • EUR 495.00
  • EUR 356.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Macrosialin (CD68) Antibody

abx224057-100ug 100 ug
EUR 411
  • Shipped within 5-10 working days.

Macrosialin (CD68) Antibody

20-abx210921
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Macrosialin (CD68) Antibody

abx149096-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Macrosialin (CD68) Antibody

20-abx159412
  • EUR 272.00
  • EUR 230.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

CD68 Blocking Peptide

20-abx161328
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

CD68 Conjugated Antibody

C49067 100ul
EUR 397

CD68(KP1) Antibody

BNUB0512-100 100uL
EUR 209
Description: Primary antibody against CD68(KP1), Concentration: 0.2mg/mL

CD68(KP1) Antibody

BNUB0512-500 500uL
EUR 458
Description: Primary antibody against CD68(KP1), Concentration: 0.2mg/mL

CD68(KP1) Antibody

BNUM0512-50 50uL
EUR 395
Description: Primary antibody against CD68(KP1), 1mg/mL

CD68(KP1) Antibody

BNC040512-100 100uL
EUR 199
Description: Primary antibody against CD68(KP1), CF405S conjugate, Concentration: 0.1mg/mL

CD68(KP1) Antibody

BNC040512-500 500uL
EUR 544
Description: Primary antibody against CD68(KP1), CF405S conjugate, Concentration: 0.1mg/mL

CD68(KP1) Antibody

BNC550512-100 100uL
EUR 199
Description: Primary antibody against CD68(KP1), CF555 conjugate, Concentration: 0.1mg/mL

CD68(KP1) Antibody

BNC550512-500 500uL
EUR 544
Description: Primary antibody against CD68(KP1), CF555 conjugate, Concentration: 0.1mg/mL

CD68(KP1) Antibody

BNC610512-100 100uL
EUR 199
Description: Primary antibody against CD68(KP1), CF660R conjugate, Concentration: 0.1mg/mL

CD68(KP1) Antibody

BNC610512-500 500uL
EUR 544
Description: Primary antibody against CD68(KP1), CF660R conjugate, Concentration: 0.1mg/mL

CD68(KP1) Antibody

BNC470512-100 100uL
EUR 199
Description: Primary antibody against CD68(KP1), CF647 conjugate, Concentration: 0.1mg/mL

CD68(KP1) Antibody

BNC470512-500 500uL
EUR 544
Description: Primary antibody against CD68(KP1), CF647 conjugate, Concentration: 0.1mg/mL

CD68(KP1) Antibody

BNC050512-100 100uL
EUR 199
Description: Primary antibody against CD68(KP1), CF405M conjugate, Concentration: 0.1mg/mL

CD68(KP1) Antibody

BNC050512-500 500uL
EUR 544
Description: Primary antibody against CD68(KP1), CF405M conjugate, Concentration: 0.1mg/mL

CD68(KP1) Antibody

BNC400512-100 100uL
EUR 199
Description: Primary antibody against CD68(KP1), CF640R conjugate, Concentration: 0.1mg/mL

CD68(KP1) Antibody

BNC400512-500 500uL
EUR 544
Description: Primary antibody against CD68(KP1), CF640R conjugate, Concentration: 0.1mg/mL

CD68(KP1) Antibody

BNC430512-100 100uL
EUR 199
Description: Primary antibody against CD68(KP1), CF543 conjugate, Concentration: 0.1mg/mL

CD68(KP1) Antibody

BNC430512-500 500uL
EUR 544
Description: Primary antibody against CD68(KP1), CF543 conjugate, Concentration: 0.1mg/mL

Macrosialin (CD68) Antibody

20-abx320165
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Macrosialin (CD68) Antibody

20-abx323675
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Macrosialin (CD68) Antibody

abx231491-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

CD68-Specific Antibody

abx231493-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Macrosialin (CD68) Protein

20-abx262543
  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

CD68(KP1) Antibody

BNC800512-100 100uL
EUR 199
Description: Primary antibody against CD68(KP1), CF680 conjugate, Concentration: 0.1mg/mL

CD68(KP1) Antibody

BNC800512-500 500uL
EUR 544
Description: Primary antibody against CD68(KP1), CF680 conjugate, Concentration: 0.1mg/mL

CD68(KP1) Antibody

BNCP0512-250 250uL
EUR 383
Description: Primary antibody against CD68(KP1), PerCP conjugate, Concentration: 0.1mg/mL

CD68(KP1) Antibody

BNCR0512-250 250uL
EUR 383
Description: Primary antibody against CD68(KP1), RPE conjugate, Concentration: 0.1mg/mL

CD68(KP1) Antibody

BNCA0512-250 250uL
EUR 383
Description: Primary antibody against CD68(KP1), APC conjugate, Concentration: 0.1mg/mL

CD68(KP1) Antibody

BNCAP0512-100 100uL
EUR 199
Description: Primary antibody against CD68(KP1), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

CD68(KP1) Antibody

BNCAP0512-500 500uL
EUR 544
Description: Primary antibody against CD68(KP1), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

CD68(KP1) Antibody

BNCB0512-100 100uL
EUR 199
Description: Primary antibody against CD68(KP1), Biotin conjugate, Concentration: 0.1mg/mL

CD68(KP1) Antibody

BNCB0512-500 500uL
EUR 544
Description: Primary antibody against CD68(KP1), Biotin conjugate, Concentration: 0.1mg/mL

CD68(KP1) Antibody

BNCH0512-100 100uL
EUR 199
Description: Primary antibody against CD68(KP1), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

CD68(KP1) Antibody

BNCH0512-500 500uL
EUR 544
Description: Primary antibody against CD68(KP1), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

CD68(KP1) Antibody

BNC940512-100 100uL
EUR 199
Description: Primary antibody against CD68(KP1), CF594 conjugate, Concentration: 0.1mg/mL

CD68(KP1) Antibody

BNC940512-500 500uL
EUR 544
Description: Primary antibody against CD68(KP1), CF594 conjugate, Concentration: 0.1mg/mL

CD68(KP1) Antibody

BNC700512-100 100uL
EUR 199
Description: Primary antibody against CD68(KP1), CF770 conjugate, Concentration: 0.1mg/mL

CD68(KP1) Antibody

BNC700512-500 500uL
EUR 544
Description: Primary antibody against CD68(KP1), CF770 conjugate, Concentration: 0.1mg/mL

CD68(KP1) Antibody

BNC880512-100 100uL
EUR 199
Description: Primary antibody against CD68(KP1), CF488A conjugate, Concentration: 0.1mg/mL

CD68(KP1) Antibody

BNC880512-500 500uL
EUR 544
Description: Primary antibody against CD68(KP1), CF488A conjugate, Concentration: 0.1mg/mL

CD68(KP1) Antibody

BNC810512-100 100uL
EUR 199
Description: Primary antibody against CD68(KP1), CF680R conjugate, Concentration: 0.1mg/mL

CD68(KP1) Antibody

BNC810512-500 500uL
EUR 544
Description: Primary antibody against CD68(KP1), CF680R conjugate, Concentration: 0.1mg/mL

CD68(KP1) Antibody

BNC680512-100 100uL
EUR 199
Description: Primary antibody against CD68(KP1), CF568 conjugate, Concentration: 0.1mg/mL

CD68(KP1) Antibody

BNC680512-500 500uL
EUR 544
Description: Primary antibody against CD68(KP1), CF568 conjugate, Concentration: 0.1mg/mL

CD68 cloning plasmid

CSB-CL004951HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1065
  • Sequence: atgaggctggctgtgcttttctcgggggccctgctggggctactggcagcccaggggacagggaatgactgtcctcacaaaaaatcagctactttgctgccatccttcacggtgacacccacggttacagagagcactggaacaaccagccacaggactaccaagagccacaaaa
  • Show more
Description: A cloning plasmid for the CD68 gene.

CD68 Polyclonal Antibody

ABP52941-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human CD68
  • Applications tips:
Description: A polyclonal antibody for detection of CD68 from Human. This CD68 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human CD68

CD68 Polyclonal Antibody

ABP52941-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human CD68
  • Applications tips:
Description: A polyclonal antibody for detection of CD68 from Human. This CD68 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human CD68

CD68 Polyclonal Antibody

ABP52941-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human CD68
  • Applications tips:
Description: A polyclonal antibody for detection of CD68 from Human. This CD68 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human CD68

CD68 Monoclonal Antibody

ABM40050-003ml 0.03ml
EUR 158
  • Immunogen information: Synthetic Peptide
  • Applications tips:
Description: A monoclonal antibody for detection of CD68 from Human, Mouse, Rat. This CD68 antibody is for IHC-P, IF. It is affinity-purified from mouse ascites by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in mouse by using as an immunogen synthetic peptide

CD68 Monoclonal Antibody

ABM40050-01ml 0.1ml
EUR 289
  • Immunogen information: Synthetic Peptide
  • Applications tips:
Description: A monoclonal antibody for detection of CD68 from Human, Mouse, Rat. This CD68 antibody is for IHC-P, IF. It is affinity-purified from mouse ascites by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in mouse by using as an immunogen synthetic peptide

CD68 Monoclonal Antibody

ABM40050-02ml 0.2ml
EUR 414
  • Immunogen information: Synthetic Peptide
  • Applications tips:
Description: A monoclonal antibody for detection of CD68 from Human, Mouse, Rat. This CD68 antibody is for IHC-P, IF. It is affinity-purified from mouse ascites by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in mouse by using as an immunogen synthetic peptide

CD68 Monoclonal Antibody

ABM40161-003ml 0.03ml
EUR 158
  • Immunogen information: Synthetic Peptide
  • Applications tips:
Description: A monoclonal antibody for detection of CD68 from Human, Mouse, Rat. This CD68 antibody is for IHC-P. It is affinity-purified from mouse ascites by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in mouse by using as an immunogen synthetic peptide

CD68 Monoclonal Antibody

ABM40161-01ml 0.1ml
EUR 289
  • Immunogen information: Synthetic Peptide
  • Applications tips:
Description: A monoclonal antibody for detection of CD68 from Human, Mouse, Rat. This CD68 antibody is for IHC-P. It is affinity-purified from mouse ascites by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in mouse by using as an immunogen synthetic peptide

CD68 Monoclonal Antibody

ABM40161-02ml 0.2ml
EUR 414
  • Immunogen information: Synthetic Peptide
  • Applications tips:
Description: A monoclonal antibody for detection of CD68 from Human, Mouse, Rat. This CD68 antibody is for IHC-P. It is affinity-purified from mouse ascites by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in mouse by using as an immunogen synthetic peptide

CD68 Rabbit pAb

A6554-100ul 100 ul
EUR 308

CD68 Rabbit pAb

A6554-200ul 200 ul
EUR 459

CD68 Rabbit pAb

A6554-20ul 20 ul
EUR 183

CD68 Rabbit pAb

A6554-50ul 50 ul
EUR 223

Cd68 Polyclonal Antibody

A56178 100 µg
EUR 570.55
Description: reagents widely cited

CD68 Rabbit pAb

A5515-100ul 100 ul
EUR 384

CD68 Rabbit pAb

A5515-200ul 200 ul Ask for price

CD68 Rabbit pAb

A5515-20ul 20 ul Ask for price

CD68 Rabbit pAb

A5515-50ul 50 ul
EUR 265

CD68 Rabbit pAb

A15037-100ul 100 ul
EUR 308

CD68 Rabbit pAb

A15037-200ul 200 ul
EUR 459

CD68 Rabbit pAb

A15037-20ul 20 ul
EUR 183

CD68 Rabbit pAb

A15037-50ul 50 ul
EUR 223

CD68 Polyclonal Antibody

ES3940-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD68 from Human. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

CD68 Polyclonal Antibody

ES3940-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD68 from Human. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

CD68 Monoclonal Antibody

EM1050-100ul 100ul
EUR 279
Description: A Mouse Monoclonal antibody against CD68 from Human/ Rat/ Mouse. This antibody is tested and validated for IHC

CD68 Monoclonal Antibody

EM1050-50ul 50ul
EUR 207
Description: A Mouse Monoclonal antibody against CD68 from Human/ Rat/ Mouse. This antibody is tested and validated for IHC

CD68 Monoclonal Antibody

EM1162-100ul 100ul
EUR 279
Description: A Mouse Monoclonal antibody against CD68 from Human/ Rat/ Mouse. This antibody is tested and validated for IHC

CD68 Monoclonal Antibody

EM1162-50ul 50ul
EUR 207
Description: A Mouse Monoclonal antibody against CD68 from Human/ Rat/ Mouse. This antibody is tested and validated for IHC

anti- CD68 antibody

FNab01491 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: CD68 molecule
  • Uniprot ID: P34810
  • Gene ID: 968
  • Research Area: Neuroscience, Stem Cells, Immunology, Cancer
Description: Antibody raised against CD68

anti- CD68 antibody

FNab01492 100µg
EUR 505.25
  • Recommended dilution: IHC: 1:500-1:2000
  • Immunogen: CD68 molecule
  • Uniprot ID: P34810
  • Gene ID: 968
  • Research Area: Neuroscience, Stem Cells, Immunology, Cancer
Description: Antibody raised against CD68

Anti-CD68 Antibody

PA1518 100ug/vial
EUR 334

Anti-CD68 Antibody

PA1518-1 100ug/vial
EUR 334

Anti-CD68 Antibody

PA2018 100ug/vial
EUR 334

anti-CD68 (6F3)

LF-MA20343 100 ug
EUR 354
Description: Mouse monoclonal to CD68

Anti-CD68 antibody

PAab01491 100 ug
EUR 355

Anti-CD68 antibody

STJ27466 100 µl
EUR 393
Description: This gene encodes a 110-kD transmembrane glycoprotein that is highly expressed by human monocytes and tissue macrophages. It is a member of the lysosomal/endosomal-associated membrane glycoprotein (LAMP) family. The protein primarily localizes to lysosomes and endosomes with a smaller fraction circulating to the cell surface. It is a type I integral membrane protein with a heavily glycosylated extracellular domain and binds to tissue- and organ-specific lectins or selectins. The protein is also a member of the scavenger receptor family. Scavenger receptors typically function to clear cellular debris, promote phagocytosis, and mediate the recruitment and activation of macrophages. Alternative splicing results in multiple transcripts encoding different isoforms.

Anti-CD68 antibody

STJ28637 100 µl
EUR 277
Description: This gene encodes a 110-kD transmembrane glycoprotein that is highly expressed by human monocytes and tissue macrophages. It is a member of the lysosomal/endosomal-associated membrane glycoprotein (LAMP) family. The protein primarily localizes to lysosomes and endosomes with a smaller fraction circulating to the cell surface. It is a type I integral membrane protein with a heavily glycosylated extracellular domain and binds to tissue- and organ-specific lectins or selectins. The protein is also a member of the scavenger receptor family. Scavenger receptors typically function to clear cellular debris, promote phagocytosis, and mediate the recruitment and activation of macrophages. Alternative splicing results in multiple transcripts encoding different isoforms.

Anti-CD68 antibody

STJ115250 100 µl
EUR 277
Description: This gene encodes a 110-kD transmembrane glycoprotein that is highly expressed by human monocytes and tissue macrophages. It is a member of the lysosomal/endosomal-associated membrane glycoprotein (LAMP) family. The protein primarily localizes to lysosomes and endosomes with a smaller fraction circulating to the cell surface. It is a type I integral membrane protein with a heavily glycosylated extracellular domain and binds to tissue- and organ-specific lectins or selectins. The protein is also a member of the scavenger receptor family. Scavenger receptors typically function to clear cellular debris, promote phagocytosis, and mediate the recruitment and activation of macrophages. Alternative splicing results in multiple transcripts encoding different isoforms.
It was discovered that (1) Haikou and Lhasa’s efficiencies have been 1 and have been one of the best in all Three years, and Shijiazhuang, Jinan and Shenyang’s have been essentially the most improved; (2) there was a niche between the japanese, central and western technological frontiers, with Chengdu, Hohhot, Chongqing, and Nanchang having technological hole ratios beneath 0.70 within the western and central Chinese areas, and Haikou, Guangzhou, and Shanghai in japanese China having technological hole ratios above 0.90 in all Three years; and (3) the variations within the well being therapy stage have been higher than within the manufacturing stage, indicating that technological adjustments and effectivity enhancements within the well being therapy phases in every metropolis weren’t secure.